dolpp1

Ensembl ID:
ENSDARG00000036915
ZFIN ID:
ZDB-GENE-041024-11
Description:
dolichyldiphosphatase 1 [Source:RefSeq peptide;Acc:NP_001007062]
Human Orthologue:
DOLPP1
Human Description:
dolichyl pyrophosphate phosphatase 1 [Source:HGNC Symbol;Acc:29565]
Mouse Orthologue:
Dolpp1
Mouse Description:
dolichyl pyrophosphate phosphatase 1 Gene [Source:MGI Symbol;Acc:MGI:1914093]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11179 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053609 Nonsense 50 213 2 7
Genomic Location (Zv9):
Chromosome 21 (position 4274690)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3739394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAGATCTCWTTTTTCGGGGGTCTGATCATGAACGAGGGCTTMAACTG[G/A]CTGCTCAAACACATCCTACAGGAGCCTCGGCCGTGCGGAGGTGAGTTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link