arih1l

Ensembl ID:: ENSDARG00000036870
ZFIN ID:: ZDB-GENE-040426-2395
Description:: ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 like [Source:RefSeq peptide;Acc
Human Orthologue:: ARIH1
Human Description:: ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) [Source:HGNC Symbol
Mouse Orthologue:: Arih1
Mouse Description:: ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila) Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa18366	Nonsense	Available for shipment	Available now
sa7060	Essential Splice Site	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa18366
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000053535	Nonsense	80	533	1	14

Genomic Location:: Chromosome 7 (position 14319023)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CGGCGGCCCAGGGCCCGGACAGGAGGATGAGGACTACCGCTTCGAGGTGT[T/A]GACCACCGAGCAGATCCTCCAGCACATGGTGGAGTGCATCAGGGATGTCA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa7060
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: A > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000053535	Essential Splice Site	469	533	13	14

Genomic Location:: Chromosome 7 (position 14336532)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TTAGAGTTTTTAACTAAACTTTCCCTTTAAGTGCATGTTTTGTATGTTTC[A/T]GAACAATCAGGCTGATTTGGAGAACGCTACGGAGGTGCTCTCGGGTTATC
Associated Phenotype:: Not determined

OMIM

OMIM information for ARIH1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: