
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
arih1l
- Ensembl ID:
- ENSDARG00000036870
- ZFIN ID:
- ZDB-GENE-040426-2395
- Description:
- ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 like [Source:RefSeq peptide;Acc
- Human Orthologue:
- ARIH1
- Human Description:
- ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) [Source:HGNC Symbol
- Mouse Orthologue:
- Arih1
- Mouse Description:
- ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila) Gene [Source:MGI Symb
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18366 | Nonsense | Available for shipment | Available now |
sa7060 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18366
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053535 | Nonsense | 80 | 533 | 1 | 14 |
- Genomic Location (Zv9):
- Chromosome 7 (position 14319023)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 13239083 GRCz11 7 13491803 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGGCGGCCCAGGGCCCGGACAGGAGGATGAGGACTACCGCTTCGAGGTGT[T/A]GACCACCGAGCAGATCCTCCAGCACATGGTGGAGTGCATCAGGGATGTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7060
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053535 | Essential Splice Site | 469 | 533 | 13 | 14 |
- Genomic Location (Zv9):
- Chromosome 7 (position 14336532)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 13256592 GRCz11 7 13509312 - KASP Assay ID:
- 554-5202.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAGAGTTTTTAACTAAACTTTCCCTTTAAGTGCATGTTTTGTATGTTTC[A/T]GAACAATCAGGCTGATTTGGAGAACGCTACGGAGGTGCTCTCGGGTTATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: