arih1l

Ensembl ID:
ENSDARG00000036870
ZFIN ID:
ZDB-GENE-040426-2395
Description:
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 like [Source:RefSeq peptide;Acc
Human Orthologue:
ARIH1
Human Description:
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) [Source:HGNC Symbol
Mouse Orthologue:
Arih1
Mouse Description:
ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila) Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18366 Nonsense Available for shipment Available now
sa7060 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053535 Nonsense 80 533 1 14
Genomic Location:
Chromosome 7 (position 14319023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCGGCCCAGGGCCCGGACAGGAGGATGAGGACTACCGCTTCGAGGTGT[T/A]GACCACCGAGCAGATCCTCCAGCACATGGTGGAGTGCATCAGGGATGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053535 Essential Splice Site 469 533 13 14
Genomic Location:
Chromosome 7 (position 14336532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGAGTTTTTAACTAAACTTTCCCTTTAAGTGCATGTTTTGTATGTTTC[A/T]GAACAATCAGGCTGATTTGGAGAACGCTACGGAGGTGCTCTCGGGTTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0iazz876