myo1d

Ensembl ID:
ENSDARG00000036863
Human Orthologue:
MYO1D
Human Description:
myosin ID [Source:HGNC Symbol;Acc:7598]
Mouse Orthologue:
Myo1d
Mouse Description:
myosin ID Gene [Source:MGI Symbol;Acc:MGI:107728]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35309 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24915 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35308 Nonsense Mutation detected in F1 DNA During 2016
sa42047 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38899 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067762 Essential Splice Site 188 1004 4 22
Genomic Location:
Chromosome 12 (position 30052481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAGGAGACCCCATTGGCGGCCATATCAACAACTACCTGCTTGAGAAG[G/A]TAGGGGGCGCTTAATTACTTCCTTTAAAATTATATTTAAAAGAATACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067762 Essential Splice Site 394 1004 9 22
Genomic Location:
Chromosome 12 (position 30044714)
KASP Assay ID:
554-7619.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATTGGAGTTCTGGACATCTATGGCTTTGAGATCTTTCAGAATAACAG[G/A]TAAGAGCATAATACTGTACCATAGAGATATTTTGTCTCTGTGCATAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067762 Nonsense 447 1004 11 22
Genomic Location:
Chromosome 12 (position 30044320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAACAGATTGACTACTTCAACAATCAGATCATCGTAGATCTCGTGGAA[C/T]AGCAGCATAAGGGCATTTTTGCAGTGCTGGATGAAGCATGCATGAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067762 Essential Splice Site 538 1004 13 22
Genomic Location:
Chromosome 12 (position 30026315)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAACAAGGACACCTTATTTCAGGACTTCAAGAGGTTACTTTACAACAG[G/A]TCTGTATTATCATACAATAATACAGTGCCTCCATTCTTATTTACATACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067762 Essential Splice Site 582 1004 14 22
Genomic Location:
Chromosome 12 (position 30026099)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTCAAAAACTCCATGATATCTCTGGTGGAGAAGCTGGCCAGCAAGG[C/T]AAGTTTATTTGAAAAAGTTTTGTGTATACTATGATTAGTGTCAGACGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link