tsen54

Ensembl ID:
ENSDARG00000036844
ZFIN ID:
ZDB-GENE-050522-454
Description:
tRNA-splicing endonuclease subunit Sen54 [Source:RefSeq peptide;Acc:NP_001018365]
Human Orthologue:
TSEN54
Human Description:
tRNA splicing endonuclease 54 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:27561]
Mouse Orthologue:
Tsen54
Mouse Description:
tRNA splicing endonuclease 54 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1923515]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053482 None None 397 None 11
ENSDART00000113247 Nonsense 889 891 19 19
Genomic Location:
Chromosome 3 (position 61408881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTATGCAACCACTGTCCTTCTGTTTCTGATAGTGCTGTCCATCGCTTG[G/A]TTCCCATGAGGAAACATATACAACTACACACATGAKCAGGAGATGGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rt8oiex6