tsen54

Ensembl ID:
ENSDARG00000036844
ZFIN ID:
ZDB-GENE-050522-454
Description:
tRNA-splicing endonuclease subunit Sen54 [Source:RefSeq peptide;Acc:NP_001018365]
Human Orthologue:
TSEN54
Human Description:
tRNA splicing endonuclease 54 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:27561]
Mouse Orthologue:
Tsen54
Mouse Description:
tRNA splicing endonuclease 54 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1923515]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33341 Nonsense Mutation detected in F1 DNA During 2016
sa26172 Nonsense Mutation detected in F1 DNA During 2016
sa12932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053482   None 397 4 11
ENSDART00000113247 Nonsense 101 891 4 19
Genomic Location:
Chromosome 3 (position 61377808)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATAGTCAGCTCTTAGTAGTTCTTTGTTTTTTGCAGGGGAAGTTTTGG[C/T]AGACGATGGGTTTTTCAGAAAGAGGCAAGCAGTATCTGCAACCCGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053482 Nonsense 40 397 5 11
ENSDART00000113247 Nonsense 142 891 5 19
Genomic Location:
Chromosome 3 (position 61378874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTGCAGGTGTTTTACCGGGACCTTCCTCTGTCCATTCAGGACGGATA[T/G]GAGCGGTTTCTGTCCTCTGACACTGTGACTCTTCATCAGTATCAGGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053482   None 397 None 11
ENSDART00000113247 Nonsense 889 891 19 19
Genomic Location:
Chromosome 3 (position 61408881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTATGCAACCACTGTCCTTCTGTTTCTGATAGTGCTGTCCATCGCTTG[G/A]TTCCCATGAGGAAACATATACAACTACACACATGAKCAGGAGATGGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link