krt15

Ensembl ID:
ENSDARG00000036840
ZFIN ID:
ZDB-GENE-040426-2931
Description:
keratin 15 [Source:RefSeq peptide;Acc:NP_998688]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6196 Nonsense Mutation detected in F1 DNA During 2017
sa35040 Nonsense Mutation detected in F1 DNA During 2017
sa35039 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025016 Nonsense 9 460 2 8
ENSDART00000104250 Nonsense 19 449 1 8
ENSDART00000104254 Nonsense 9 460 1 7
ENSDART00000104260   None 361 None 8
Genomic Location (Zv9):
Chromosome 11 (position 11639743)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11534746
KASP Assay ID:
554-4985.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACTCTCCTCCGCACCGCAGCAATGACRTCCTTCAGCAGCCGTAGTTA[T/A]GTGTCCTCTGGAGGGGGCTTCGGYGGAGGCTCCCTGCGGGGTGCTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025016 Nonsense 230 460 4 8
ENSDART00000104250 Nonsense 219 449 4 8
ENSDART00000104254 Nonsense 230 460 3 7
ENSDART00000104260 Nonsense 170 361 4 8
Genomic Location (Zv9):
Chromosome 11 (position 11638786)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11533789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGAGACTACTGGATGAGCTGACGCTGGCCAGATCTGACCTGGAGATG[C/T]AGATTGAGGGCTTAAAGGAGGAGCTTATCTTCCTCAAGAAGAACCATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025016 Essential Splice Site 417 460 7 8
ENSDART00000104250 Essential Splice Site 406 449 7 8
ENSDART00000104254 Essential Splice Site 417 460 6 7
ENSDART00000104260 Essential Splice Site 357 361 7 8
Genomic Location (Zv9):
Chromosome 11 (position 11637459)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11532462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGAGATTGCGGAGTACAGAAGACTGCTGGATGGGGGAGCAAGCAGG[T/C]AGGAGATGTTGGAAGATGGATATTTATGTGAGTGTGCTTGTGCGAAACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link