rnf41

Ensembl ID:
ENSDARG00000036831
ZFIN ID:
ZDB-GENE-040426-2920
Description:
E3 ubiquitin-protein ligase NRDP1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW16]
Human Orthologue:
RNF41
Human Description:
ring finger protein 41 [Source:HGNC Symbol;Acc:18401]
Mouse Orthologue:
Rnf41
Mouse Description:
ring finger protein 41 Gene [Source:MGI Symbol;Acc:MGI:1914838]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37757 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053472 Nonsense 273 318 7 7

The following transcripts of ENSDARG00000036831 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 32550181)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32385071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAGGTTTGGCCACGCTGGAGACGCGGCAGATGAACCGCCGTTACTAT[G/T]AAAACTATGTAGCCAAACGCATCCCGGGGAAACAAGCGGTGGTGGTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link