ENSDARG00000036829

Ensembl ID:
ENSDARG00000036829
Human Orthologue:
L1TD1
Human Description:
LINE-1 type transposase domain containing 1 [Source:HGNC Symbol;Acc:25595]
Mouse Orthologue:
L1td1
Mouse Description:
LINE-1 type transposase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3578435]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35662 Nonsense Mutation detected in F1 DNA During 2016
sa42366 Nonsense Mutation detected in F1 DNA During 2016
sa2768 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa35662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053471 Nonsense 18 328 1 2
Genomic Location (Zv9):
Chromosome 14 (position 17322645)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 13601086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTATGGAACGAAGGGGAAGACAAAAAAGAAACACGCCAAAAGACGAC[G/T]AAAACAACCCAAATGTACCTGAGCAAACTAGCACGAGCGGCGACGCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053471 Nonsense 81 328 1 2
Genomic Location (Zv9):
Chromosome 14 (position 17322456)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 13601275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGACATAAAAGAAGAATTAAACAAGTCCAATAAAAGAATCGAAGAG[G/T]GACTTCCGGTTATGGAGTGGTAGCGAAAAGACGTGAGATAACGACCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2768
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053471 Nonsense 193 328 2 2
Genomic Location (Zv9):
Chromosome 14 (position 17321911)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 13601820
KASP Assay ID:
554-3378.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAAACAGAAACAGAYGGAACAACCTGAGGCTAGTGGGTTTGCCGGAA[C/T]GAGAAGAGGGGGCAGAYGCGGGTGCGTTTTTGGAGGACTTTATTCCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link