ankrd52

Ensembl ID:
ENSDARG00000036826
ZFIN ID:
ZDB-GENE-050522-247
Description:
Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit C [Source:UniProtKB/Swiss-P
Human Orthologue:
ANKRD52
Human Description:
ankyrin repeat domain 52 [Source:HGNC Symbol;Acc:26614]
Mouse Orthologues:
Ankrd52, E230028L10Rik
Mouse Descriptions:
ankyrin repeat domain 52 Gene [Source:MGI Symbol;Acc:MGI:2444029]
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24380 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032861 Essential Splice Site 328 1071 9 28
Genomic Location:
Chromosome 23 (position 32619246)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCCATTCATGGACGTTTCACTCGCTCTCAGATCCTCATTCAGAATG[G/T]TTAGTTTTTTCTTTTTCTAATTGATTTTCATTTGTTTTTATGAGCTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/95r0nmsp