si:dkey-20d21.13

Ensembl ID:
ENSDARG00000036818
ZFIN ID:
ZDB-GENE-081104-366
Description:
hyaluronidase-3 [Source:RefSeq peptide;Acc:NP_001121765]
Human Orthologue:
HYAL3
Human Description:
hyaluronoglucosaminidase 3 [Source:HGNC Symbol;Acc:5322]
Mouse Orthologue:
Hyal3
Mouse Description:
hyaluronoglucosaminidase 3 Gene [Source:MGI Symbol;Acc:MGI:1330288]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9395 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086763 Nonsense 253 428 1 3
ENSDART00000132787 Nonsense 253 428 2 4
Genomic Location (Zv9):
Chromosome 8 (position 27230466)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26358384
KASP Assay ID:
2260-0675.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTAAATGATAGACTGGGGTTTYTATGGCAACAATCCACTGCCCTGTA[T/A]CCAAGCATTTATTTGTGGCGTAAACTGGCCGGACACACACACGCTCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link