ATP1A3 (2 of 2)

Ensembl ID:
ENSDARG00000036815
Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide [Source:HGNC Symbol;Acc:801]
Human Orthologue:
ATP1A3
Human Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide [Source:HGNC Symbol;Acc:801]
Mouse Orthologue:
Atp1a3
Mouse Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88107]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36052 Nonsense Mutation detected in F1 DNA During 2016
sa8659 Nonsense Available for shipment Available now
sa9603 Nonsense Available for shipment Available now
sa22768 Nonsense Available for shipment Available now
sa6413 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 474 905 10 17
ENSDART00000124130 Nonsense 475 920 10 17
Genomic Location (Zv9):
Chromosome 16 (position 12414327)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10913993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTATCGAGCTGTCCAGTGGCTCAGTCAAAGCAATGAGAGAAAAGAAC[A/T]AGAAAGTAGCCGAAATCCCATTCAACTCCACCAACAAATATCAGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
Genomic Location (Zv9):
Chromosome 16 (position 12416892)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10916558
KASP Assay ID:
2260-9279.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACCCYATCACTGCCAAGGCCATCGCCAAGGGTGTGGGCATCATCTCA[G/T]AGGGTAACGARACTGTGGAAGACATCGCTGCCCGTCTCAACATCCCTGWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
Genomic Location (Zv9):
Chromosome 16 (position 12416892)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10916558
KASP Assay ID:
2260-9279.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACCCYATCACTGCCAAGGCCATCGCCAAGGGTGTGGGCATCATCTCA[G/T]AGGGTAACGARACTGTGGAAGACATCGCTGCCCGTCTCAACATCCCTGWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 662 905 13 17
ENSDART00000124130 Nonsense 663 920 13 17
Genomic Location (Zv9):
Chromosome 16 (position 12418903)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10918569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTATCAAGAATTTCTTGTTTGTATGTTTTAGGGATGCCAAAGCCTG[T/A]GTTATACATGGAACAGATCTGAAAGACTATTCTCAGGAGCAAATAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Essential Splice Site 815 905 15 17
ENSDART00000124130 Essential Splice Site 816 920 15 17
Genomic Location (Zv9):
Chromosome 16 (position 12422653)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10922319
KASP Assay ID:
554-4031.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCCTCGGCACCATMACCATCCTCTGTATCGACCTGGGAACTGACATGG[T/G]GAGCATTAGTATTAGCCTTAGTATAGAAATAYTATGTTCTGATATCCTRA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link