ATP1A3 (2 of 2)

Ensembl ID:
ENSDARG00000036815
Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide [Source:HGNC Symbol;Acc:801]
Human Orthologue:
ATP1A3
Human Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide [Source:HGNC Symbol;Acc:801]
Mouse Orthologue:
Atp1a3
Mouse Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88107]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7779 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8659 Nonsense Available for shipment Available now
sa9603 Nonsense Available for shipment Available now
sa22768 Nonsense Mutation detected in F1 DNA During 2014
sa6413 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Essential Splice Site 1 905 1 17
ENSDART00000124130 None None 920 None 17
Genomic Location:
Chromosome 16 (position 12404360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTCTGTGCTGGTTGTTCTGGAAGCTCGGTATTGRTCAGCCGGTGGTG[T/C]TAGATGATACACAGGTTCCTGCTTTAATGATGACTGTTCCCCTAAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
Genomic Location:
Chromosome 16 (position 12416892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACCCYATCACTGCCAAGGCCATCGCCAAGGGTGTGGGCATCATCTCA[G/T]AGGGTAACGARACTGTGGAAGACATCGCTGCCCGTCTCAACATCCCTGWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
ENSDART00000011121 Nonsense 635 905 12 17
ENSDART00000124130 Nonsense 636 920 12 17
Genomic Location:
Chromosome 16 (position 12416892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACCCYATCACTGCCAAGGCCATCGCCAAGGGTGTGGGCATCATCTCA[G/T]AGGGTAACGARACTGTGGAAGACATCGCTGCCCGTCTCAACATCCCTGWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Nonsense 662 905 13 17
ENSDART00000124130 Nonsense 663 920 13 17
Genomic Location:
Chromosome 16 (position 12418903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTATCAAGAATTTCTTGTTTGTATGTTTTAGGGATGCCAAAGCCTG[T/A]GTTATACATGGAACAGATCTGAAAGACTATTCTCAGGAGCAAATAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011121 Essential Splice Site 815 905 15 17
ENSDART00000124130 Essential Splice Site 816 920 15 17
Genomic Location:
Chromosome 16 (position 12422653)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCCTCGGCACCATMACCATCCTCTGTATCGACCTGGGAACTGACATGG[T/G]GAGCATTAGTATTAGCCTTAGTATAGAAATAYTATGTTCTGATATCCTRA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fydffily