ifrd2

Ensembl ID:
ENSDARG00000036811
ZFIN ID:
ZDB-GENE-040801-140
Description:
interferon-related developmental regulator 2 [Source:RefSeq peptide;Acc:NP_001003621]
Human Orthologue:
IFRD2
Human Description:
interferon-related developmental regulator 2 [Source:HGNC Symbol;Acc:5457]
Mouse Orthologue:
Ifrd2
Mouse Description:
interferon-related developmental regulator 2 Gene [Source:MGI Symbol;Acc:MGI:1316708]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21307 Nonsense Mutation detected in F1 DNA During 2014
sa13644 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053447 Nonsense 211 435 7 12
ENSDART00000145836 None None 138 None 5
Genomic Location:
Chromosome 8 (position 27273234)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGCTGAAATCTCTTGGACACTTGGAGAGTGTGTTTGTGGGTGCGTA[T/A]CCTCTAGGCGATGGCTCTCTGCCCTCTGTCAAAGCCGGGACCCCTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053447 Essential Splice Site 409 435 11 12
ENSDART00000145836 None None 138 None 5
Genomic Location:
Chromosome 8 (position 27279191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYCCTGGATGCATCTGTCAAGGCCAGCAAGATCTCTCGCACCGAGAGGG[T/C]AATCTTACATAAAACCCTTGTCATCTGTAAACATAATAAGCCAAGCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2fs97g8c