LOC555478

Ensembl ID:
ENSDARG00000036809
Human Orthologue:
ANPEP
Human Description:
alanyl (membrane) aminopeptidase [Source:HGNC Symbol;Acc:500]
Mouse Orthologue:
Anpep
Mouse Description:
alanyl (membrane) aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:96749]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15314 Essential Splice Site Available for shipment Available now
sa8261 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5401 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053444 Essential Splice Site 197 960 2 21
ENSDART00000053444 Essential Splice Site 197 960 2 21
Genomic Location:
Chromosome 7 (position 16170551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTAATTTTTCCATTTATTAATCATGTTGATGTGATCTCTTTTGTTTCC[A/T]GGATTATTGCCATCACTCAGATGCAGGCCACATWTGCAAGAAAAGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053444 Essential Splice Site 197 960 2 21
ENSDART00000053444 Essential Splice Site 197 960 2 21
Genomic Location:
Chromosome 7 (position 16170551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTAATTTTTCCATTTATTAATCATGTTGATGTGATCTCTTTTGTTTCC[A/T]GGATTATTGCCATCACTCAGATGCAGGCCACATATGCAAGAAAAGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053444 Nonsense 577 960 11 21
Genomic Location:
Chromosome 7 (position 16157888)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCCSCTTCTTATGAGTCTAACTGCTGTGTNAAACCTCAGTTATGAATG[G/A]TTTGTGCCGATCAAMTGGATGAAGAAAGGCCAGGTGCAGGATCAGATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/27sr6wvm