LOC555478

Ensembl ID:
ENSDARG00000036809
Human Orthologue:
ANPEP
Human Description:
alanyl (membrane) aminopeptidase [Source:HGNC Symbol;Acc:500]
Mouse Orthologue:
Anpep
Mouse Description:
alanyl (membrane) aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:96749]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15314 Essential Splice Site Available for shipment Available now
sa30626 Nonsense Mutation detected in F1 DNA During 2016
sa34021 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053444 Essential Splice Site 197 960 2 21
ENSDART00000053444 Essential Splice Site 197 960 2 21
Genomic Location (Zv9):
Chromosome 7 (position 16170551)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15153430
KASP Assay ID:
2259-8540.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTAATTTTTCCATTTATTAATCATGTTGATGTGATCTCTTTTGTTTCC[A/T]GGATTATTGCCATCACTCAGATGCAGGCCACATWTGCAAGAAAAGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053444 Nonsense 481 960 8 21
Genomic Location (Zv9):
Chromosome 7 (position 16160065)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15142944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACATATGTTTATCATTACAGGGAGCTGCGGTGCTGAAAATGCTCTCC[G/T]AATTCCTGACGGAGCCTGTGTTCGCTAAGGGACTCAGTGTAAGTCTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053444 Essential Splice Site 780 960 16 21
Genomic Location (Zv9):
Chromosome 7 (position 16153167)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15136046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACCAAGAGCTGGTTTAAGAAATGGATGCAAAATCCTCGTGTCAACCC[G/A]TGAGTGCAAAACCTCAGAGGAAATTATGCAATTTTCTTTGTGGCCGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link