abcb3l1

Ensembl ID:: ENSDARG00000036787
ZFIN IDs:: ZDB-GENE-030616-245, ZDB-GENE-990415-260
Description:: ATP-binding cassette, sub-family B (MDR/TAP), member 3 like 1 [Source:RefSeq peptide;Acc:NP_0010065
Human Orthologues:: TAP2, XXbac-BPG246D15.9
Human Descriptions:: transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) [Source:HGNC Symbol;Acc:44]; Truncated antigen peptide transporter 2 [Source:UniProtKB/TrEMBL;Acc:B6VNV2]
Mouse Orthologue:: Tap2
Mouse Description:: transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene [Source:MGI Symbol;Acc:MGI:98484]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa1788	Nonsense	Available for shipment	Available now
sa412	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa1788
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000031380	Nonsense	3	725	1	11

Genomic Location:: Chromosome 19 (position 7746943)
KASP Assay ID:: 554-1781.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: ATAGCGTTTCGGTGTTACCACGGCAACCAGTTTACGCACGCACCATGCGG[A/T]AGGTTTTGGTGTTCGCGTGTATGTTATGTTTTGACATCTTAATAGTTTTG
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa412
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: A > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000031380	Nonsense	443	725	7	11

Genomic Location:

Chromosome 19 (position 7748866)

KASP Assay ID:

554-0271.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CTTTGATCTACATCTTTGGAGACATGCTGAATTCAGTAGGGGCTGCTGGT[A/T]AGGTGTTTGAGTACCAGGACCGAAAGTCTGAAGTCAGTATTGATGGAAAT

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)
Nephropathy: Genome-wide association study identifies susceptibility loci for IgA nephropathy. (View Study)
Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

Bare lymphocyte syndrome, type I, due to TAP2 deficiency

More OMIM information for TAP2

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: