abcb3l1

Ensembl ID:
ENSDARG00000036787
ZFIN IDs:
ZDB-GENE-030616-245, ZDB-GENE-990415-260
Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 3 like 1 [Source:RefSeq peptide;Acc:NP_0010065
Human Orthologues:
TAP2, XXbac-BPG246D15.9
Human Descriptions:
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) [Source:HGNC Symbol;Acc:44]
Truncated antigen peptide transporter 2 [Source:UniProtKB/TrEMBL;Acc:B6VNV2]
Mouse Orthologue:
Tap2
Mouse Description:
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene [Source:MGI Symbol;Acc:MGI:98484]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1788 Nonsense Available for shipment Available now
sa412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031380 Nonsense 3 725 1 11
Genomic Location:
Chromosome 19 (position 7746943)
KASP Assay ID:
554-1781.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCGTTTCGGTGTTACCACGGCAACCAGTTTACGCACGCACCATGCGG[A/T]AGGTTTTGGTGTTCGCGTGTATGTTATGTTTTGACATCTTAATAGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031380 Nonsense 443 725 7 11
Genomic Location:
Chromosome 19 (position 7748866)
KASP Assay ID:
554-0271.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGATCTACATCTTTGGAGACATGCTGAATTCAGTAGGGGCTGCTGGT[A/T]AGGTGTTTGAGTACCAGGACCGAAAGTCTGAAGTCAGTATTGATGGAAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)
  • Nephropathy: Genome-wide association study identifies susceptibility loci for IgA nephropathy. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/48r33pxm