
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
abcb3l1
- Ensembl ID:
- ENSDARG00000036787
- ZFIN IDs:
- ZDB-GENE-030616-245, ZDB-GENE-990415-260
- Description:
- ATP-binding cassette, sub-family B (MDR/TAP), member 3 like 1 [Source:RefSeq peptide;Acc:NP_0010065
- Human Orthologues:
- TAP2, XXbac-BPG246D15.9
- Human Descriptions:
- transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) [Source:HGNC Symbol;Acc:44]
- Truncated antigen peptide transporter 2 [Source:UniProtKB/TrEMBL;Acc:B6VNV2]
- Mouse Orthologue:
- Tap2
- Mouse Description:
- transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene [Source:MGI Symbol;Acc:MGI:98484]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1788 | Nonsense | Available for shipment | Available now |
sa43214 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa412 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1788
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031380 | Nonsense | 3 | 725 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 7746943)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 7205482 GRCz11 19 7124407 - KASP Assay ID:
- 554-1781.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATAGCGTTTCGGTGTTACCACGGCAACCAGTTTACGCACGCACCATGCGG[A/T]AGGTTTTGGTGTTCGCGTGTATGTTATGTTTTGACATCTTAATAGTTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43214
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031380 | Essential Splice Site | 382 | 725 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 7748469)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 7207008 GRCz11 19 7125933 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAAGACCCGACGGGACACAGTCAGGGCGATTTACCTGCTAATTAGGAGG[G/A]TCAGTATTTGTTTATTTTCTCTGAAGGAAACTTTTGATATTATATTGCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa412
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031380 | Nonsense | 443 | 725 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 7748866)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 7207405 GRCz11 19 7126330 - KASP Assay ID:
- 554-0271.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTTGATCTACATCTTTGGAGACATGCTGAATTCAGTAGGGGCTGCTGGT[A/T]AGGTGTTTGAGTACCAGGACCGAAAGTCTGAAGTCAGTATTGATGGAAAT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)
- Nephropathy: Genome-wide association study identifies susceptibility loci for IgA nephropathy. (View Study)
- Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: