si:dkey-170l10.1

Ensembl ID:
ENSDARG00000036781
ZFIN ID:
ZDB-GENE-030131-5201
Description:
Si:dkey-170l10.1 protein [Source:UniProtKB/TrEMBL;Acc:Q5XJW8]
Human Orthologue:
HAUS2
Human Description:
HAUS augmin-like complex, subunit 2 [Source:HGNC Symbol;Acc:25530]
Mouse Orthologue:
Haus2
Mouse Description:
HAUS augmin-like complex, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1913546]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36457 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053408 Essential Splice Site 115 233 5 8
ENSDART00000141480 Essential Splice Site 84 202 4 7

The following transcripts of ENSDARG00000036781 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 31666999)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31590926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGAATCTGGAAAGAGACTGTGCAGACGTGGCTCACAATCATTATCTCA[G/T]TAAGTGTTGCATGTTAACATTTCATTGTAAATGTCCACGCATACTTTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link