hbs1l

Ensembl ID:
ENSDARG00000036778
ZFIN ID:
ZDB-GENE-030131-2987
Description:
HBS1-like protein [Source:RefSeq peptide;Acc:NP_955970]
Human Orthologue:
HBS1L
Human Description:
HBS1-like (S. cerevisiae) [Source:HGNC Symbol;Acc:4834]
Mouse Orthologue:
Hbs1l
Mouse Description:
Hbs1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1891704]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8503 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053401 Nonsense 30 653 2 19
ENSDART00000134319 Nonsense 30 362 2 5
ENSDART00000139076 Nonsense 30 682 2 18

The following transcripts of ENSDARG00000036778 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 32048094)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31882984
KASP Assay ID:
2261-8008.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYAGACTTTGAAGATGATGACATGTATGGACAGTCAGTGGAAGATGACTA[T/A]TGCATCTCTCCAGCCACTGGTTTGTGTTTTCATATAAGTTGCTTGTGNNAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link