aldh8a1

Ensembl ID:
ENSDARG00000036776
ZFIN ID:
ZDB-GENE-040912-3
Description:
Aldehyde dehydrogenase family 8 member A1 [Source:UniProtKB/Swiss-Prot;Acc:Q66I21]
Human Orthologue:
ALDH8A1
Human Description:
aldehyde dehydrogenase 8 family, member A1 [Source:HGNC Symbol;Acc:15471]
Mouse Orthologue:
Aldh8a1
Mouse Description:
aldehyde dehydrogenase 8 family, member A1 Gene [Source:MGI Symbol;Acc:MGI:2653900]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3225 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3225
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053399 Nonsense 315 487 6 7
Genomic Location:
Chromosome 23 (position 31994747)
KASP Assay ID:
554-2957.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTTTACCCAGAATTCCTCACTCGTTTTGTGGAGGCGACTCGTCGGTGG[A/T]AAACCGGGGTTCCTTCAGACCCCTCAAATGACAATGGAGCACTCATWAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q5qf16qg