rgs12

Ensembl ID:
ENSDARG00000036774
ZFIN ID:
ZDB-GENE-031006-13
Description:
regulator of G-protein signaling 12 [Source:RefSeq peptide;Acc:NP_999889]
Human Orthologues:
RGS10, RGS12
Human Descriptions:
regulator of G-protein signaling 10 [Source:HGNC Symbol;Acc:9992]
regulator of G-protein signaling 12 [Source:HGNC Symbol;Acc:9994]
Mouse Orthologues:
Rgs10, Rgs12
Mouse Descriptions:
regulator of G-protein signaling 12 Gene [Source:MGI Symbol;Acc:MGI:1918979]
regulator of G-protein signalling 10 Gene [Source:MGI Symbol;Acc:MGI:1915115]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10087 Nonsense Available for shipment Available now
sa9277 Nonsense Mutation detected in F1 DNA During 2014
sa19543 Nonsense Mutation detected in F1 DNA During 2014
sa1121 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa10087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022546 Nonsense 578 1540 1 18
ENSDART00000101536 Nonsense 578 1183 1 17
ENSDART00000125886 Nonsense 578 1519 1 20
ENSDART00000125988 Nonsense 578 1183 1 15
ENSDART00000126853 Nonsense 578 1387 1 16

The following transcripts of ENSDARG00000036774 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 41666978)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGTCCTGAGGGATTGGCGTCAGGGACACAGCAGTGATCAGGAGTCTTA[T/A]GCAGAGTCCACAGACGGATGGTCCAGTGCTAACTGTAGCACCCTGCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022546 Nonsense 651 1540 1 18
ENSDART00000101536 Nonsense 651 1183 1 17
ENSDART00000125886 Nonsense 651 1519 1 20
ENSDART00000125988 Nonsense 651 1183 1 15
ENSDART00000126853 Nonsense 651 1387 1 16

The following transcripts of ENSDARG00000036774 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 41666760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTAMRAGAGCATTCACAACAATCGAACAATGTCAGAAGAGCTAAAGATT[C/A]AGAAAAAAAGGTAAGAKAAKCAATCAAGTCACCATTGCAAGATTTGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022546 Nonsense 832 1540 6 18
ENSDART00000101536 Nonsense 832 1183 6 17
ENSDART00000125886 Nonsense 832 1519 6 20
ENSDART00000125988 Nonsense 832 1183 6 15
ENSDART00000126853 Nonsense 832 1387 6 16

The following transcripts of ENSDARG00000036774 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 41609821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGACGACATCCTCAACGCACCGAGGCCAGACATGTTTAAAGAGCAA[C/T]AGCTTCAGGTAAGACAGGAAACGCTCAGTCAGGATGTTTACTGAAACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1121
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022546 Nonsense 1366 1540 16 18
ENSDART00000101536 None None 1183 15 17
ENSDART00000125886 Nonsense 1364 1519 17 20
ENSDART00000125988 None None 1183 15 15
ENSDART00000126853 Nonsense 1366 1387 16 16

The following transcripts of ENSDARG00000036774 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 41596864)
KASP Assay ID:
554-1032.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCTCTCTCCTTCACCAGTCCCCCATTCCTCTCCCTCCTTCCCCAGAG[C/T]GATCACACCTCCTGAAGGAGGACACTTGCCAGGACAGCTGGGCTCGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bkv8xpch