pygo2

Ensembl ID:
ENSDARG00000036772
ZFIN ID:
ZDB-GENE-050809-108
Description:
pygopus homolog 2 [Source:RefSeq peptide;Acc:NP_001028283]
Human Orthologue:
PYGO2
Human Description:
pygopus homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:30257]
Mouse Orthologue:
Pygo2
Mouse Description:
pygopus 2 Gene [Source:MGI Symbol;Acc:MGI:1916161]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43216 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046225   None 396 None 5
ENSDART00000104731 Nonsense 270 531 3 4
ENSDART00000129994 Nonsense 76 196 1 2
ENSDART00000131324 Nonsense 271 571 3 3

The following transcripts of ENSDARG00000036772 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 8253457)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7711996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTGGTGGGGGTAATATGGTGGGTGGACACCCAGGTATGCCTCCGCAA[G/T]GACAGTTTCCTCCTCCACAAGATGGCCCCTACCCTGGATCAAGTCCTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link