LOC100005729

Ensembl ID:
ENSDARG00000036767
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6143 Nonsense Mutation detected in F1 DNA During 2016
sa43217 Nonsense Mutation detected in F1 DNA During 2016
sa39228 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053382 Nonsense 45 1817 2 5
Genomic Location:
Chromosome 19 (position 8311897)
KASP Assay ID:
554-3712.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGCTGCAGGTGTGACTGCAAATAAACAACAAAAATTCCAAGTCGAAT[G/A]GAAGAATGAAGGAATWCACTTTACAAAAACAACAGATGCAAATCATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053382 Nonsense 700 1817 5 5
Genomic Location:
Chromosome 19 (position 8308213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTACAAGGATGAACTTAGAAGTCGAATACACAAACTGAAAATGGAA[C/T]AAGAAAACAGCAACATGAAACAAGTGATATCTCTGTTCATCTCTGGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053382 Nonsense 1773 1817 5 5
Genomic Location:
Chromosome 19 (position 8304992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGATACAGCCTGACTCTAGTATCGAGGCCACTGACTACTGGAAGTA[C/A]ATCTTTGCCAAGTACAACTCTAAATTTGCTGCACAATACAACGTAAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link