prmt10

Ensembl ID:
ENSDARG00000036755
ZFIN ID:
ZDB-GENE-080728-4
Description:
protein arginine methyltransferase 10 (putative) [Source:RefSeq peptide;Acc:NP_001124239]
Human Orthologue:
PRMT10
Human Description:
protein arginine methyltransferase 10 (putative) [Source:HGNC Symbol;Acc:25099]
Mouse Orthologue:
Prmt10
Mouse Description:
protein arginine methyltransferase 10 (putative) Gene [Source:MGI Symbol;Acc:MGI:2142651]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32715 Nonsense Mutation detected in F1 DNA During 2017
sa13342 Nonsense Available for shipment Available now
sa13445 Nonsense Available for shipment Available now
sa14984 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 38 859 2 13
Genomic Location (Zv9):
Chromosome 1 (position 36478880)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36038738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAAGAAATGAGCTGGTGTCAAGATCCTTGGAAAGTGCTCAGCAGTG[T/A]CTGTTCAGTGAGGACTATGGCACTGCTTTTGTTCACTATCTGTTAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 264 859 6 13
Genomic Location (Zv9):
Chromosome 1 (position 36474306)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36034164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCTCWTCAGAGTGTCGCTGGTTGTTACAGAGACTGTAGATGCAGGGY[T/A]GTTTGGTGAAGGCATCATTGAGACGYWGATTCATGCATGGAAGCACCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 273 859 6 13
Genomic Location (Zv9):
Chromosome 1 (position 36474279)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36034137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGAGACTGTAGATGCAGGGYWGTTTGGTGAAGGCATCATTGAGACGY[T/A]GATTCATGCATGGAAGCACCTGCTCCTACCTSCTCCTGTAAGTCACTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053369 Nonsense 684 859 11 13
Genomic Location (Zv9):
Chromosome 1 (position 36461031)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36020889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACRGTAGTTTGTTTGGTSAACATTTCAGGTGTTTGTWGGAGGACGGTGGA[C/T]AGATTTTTCCAGAGCGCATTGTGATCCATGGGATGCTGGTAGAGTCAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link