si:dkey-211g8.1

Ensembl ID:
ENSDARG00000036728
ZFIN ID:
ZDB-GENE-060503-436
Description:
si:dkey-211g8.1 [Source:RefSeq peptide;Acc:NP_001076360]
Human Orthologues:
C3AR1, C5AR1
Human Descriptions:
complement component 3a receptor 1 [Source:HGNC Symbol;Acc:1319]
complement component 5a receptor 1 [Source:HGNC Symbol;Acc:1338]
Mouse Orthologues:
C3ar1, C5ar1, Gpr33
Mouse Descriptions:
complement component 3a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1097680]
complement component 5a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:88232]
G protein-coupled receptor 33 Gene [Source:MGI Symbol;Acc:MGI:1277106]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16466 Nonsense Available for shipment Available now
sa31031 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003031 Nonsense 198 364 3 5
ENSDART00000138706 Nonsense 178 345 1 2
Genomic Location (Zv9):
Chromosome 19 (position 11158472)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10617701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KACTTTGTGTACCGACAAGTCTTTCCTGATAAGAAGAACTTCAGCCAATG[C/A]TTTTTCAAGGTTTGTTTTACTTTCAGTCTTAAATACTAACWTATTATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003031   None 364 None 5
ENSDART00000138706 Nonsense 344 345 2 2
Genomic Location (Zv9):
Chromosome 19 (position 11159820)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10619049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAGTTGTAATTCCTTTCCAAAGGCTGCAGTTGTTGAGTGTGTAAAT[A/T]GATTTTAAGAGTTTTTACTTTGTTTTTCTCTCTTGTTTGTTTGTCTGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link