psmd4a

Ensembl ID:
ENSDARG00000036715
ZFIN ID:
ZDB-GENE-040625-104
Description:
26S proteasome non-ATPase regulatory subunit 4 [Source:RefSeq peptide;Acc:NP_001002112]
Human Orthologue:
PSMD4
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 [Source:HGNC Symbol;Acc:9561]
Mouse Orthologue:
Psmd4
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 Gene [Source:MGI Symbol;Acc:MGI:1201670]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23470 Nonsense Available for shipment Available now
sa44908 Nonsense Mutation detected in F1 DNA During 2017
sa39237 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104063 Nonsense 58 372 3 10
Genomic Location (Zv9):
Chromosome 19 (position 11934629)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10960558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGATGCTGTTTCATGTAATAACAGACATTTTGGTTTTGTTCAGTAATTG[C/A]GAGGTCCTCACCACTTTAACACCAGACACTGGCCGCATCCTTTCAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104063 Nonsense 131 372 5 10
Genomic Location (Zv9):
Chromosome 19 (position 11937865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACTAATTTCACAAACTCTCTTCCAGCTGGTGAAGATGGCAAAGAGGT[T/A]GAAAAAAGAAAAGGTCAATGTGGATATAATCAATTTCGGAGAAGAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104063 Nonsense 292 372 8 10
Genomic Location (Zv9):
Chromosome 19 (position 11941806)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10953381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGACTTCAGCAGCATGACGGAGGAGGAGCAGATTGCGTATGCCATG[C/T]AGATGTCCCTGGCAGGGGGAGGTTCGTCCATACAACTTGTTCAATGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link