psmd4a

Ensembl ID:
ENSDARG00000036715
ZFIN ID:
ZDB-GENE-040625-104
Description:
26S proteasome non-ATPase regulatory subunit 4 [Source:RefSeq peptide;Acc:NP_001002112]
Human Orthologue:
PSMD4
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 [Source:HGNC Symbol;Acc:9561]
Mouse Orthologue:
Psmd4
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 Gene [Source:MGI Symbol;Acc:MGI:1201670]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23470 Nonsense Available for shipment Available now
sa39237 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104063 Nonsense 58 372 3 10
Genomic Location (Zv9):
Chromosome 19 (position 11934629)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10960558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGATGCTGTTTCATGTAATAACAGACATTTTGGTTTTGTTCAGTAATTG[C/A]GAGGTCCTCACCACTTTAACACCAGACACTGGCCGCATCCTTTCAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104063 Nonsense 292 372 8 10
Genomic Location (Zv9):
Chromosome 19 (position 11941806)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10953381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGACTTCAGCAGCATGACGGAGGAGGAGCAGATTGCGTATGCCATG[C/T]AGATGTCCCTGGCAGGGGGAGGTTCGTCCATACAACTTGTTCAATGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link