PLA2G4C (5 of 5)

Ensembl ID:
ENSDARG00000036713
Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) [Source:HGNC Symbol;Acc:9037]
Human Orthologue:
PLA2G4C
Human Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) [Source:HGNC Symbol;Acc:9037]
Mouse Orthologue:
Pla2g4c
Mouse Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) Gene [Source:MGI Symbol;Acc:MGI:1196403

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8473 Nonsense Mutation detected in F1 DNA During 2017
sa18037 Nonsense Available for shipment Available now
sa32237 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053320 Nonsense 21 529 1 11
Genomic Location (Zv9):
Chromosome 19 (position 11849289)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11045641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACATYGCACTGCTGGGTTCTGGAGGAAGTGAAAGAGCAATGGTGAGTT[T/A]GCTGGAATCACTGGACGCTCTGGCTCAAACTGATCTSATGGACTGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053320 Nonsense 210 529 5 11
Genomic Location (Zv9):
Chromosome 19 (position 11852835)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11042095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTATTYATCGGCAGGTCTGTGTGGTAGTAGTCTTGCTGATCCTGTA[A/T]AAATATTGGAGGAACTGATATATATAATCAAACGTAAGTTCCCTTTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053320 Essential Splice Site 483 529 10 11
Genomic Location (Zv9):
Chromosome 19 (position 11855725)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11039205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCGACTGTGATACACATTCCTCTTTTCAACAGAGTCAACTGTGGTAG[T/C]AAAGGTAATGTCATATTATTTATTTTTAAAGAATGGAGTAAAAATCTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link