si:ch73-15j19.1

Ensembl ID:
ENSDARG00000036687
ZFIN ID:
ZDB-GENE-090313-135
Description:
B-cell CLL/lymphoma 9 protein [Source:RefSeq peptide;Acc:NP_001005604]
Human Orthologue:
BCL9
Human Description:
B-cell CLL/lymphoma 9 [Source:HGNC Symbol;Acc:1008]
Mouse Orthologue:
Bcl9
Mouse Description:
B-cell CLL/lymphoma 9 Gene [Source:MGI Symbol;Acc:MGI:1924828]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13893 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053284 Nonsense 570 615 9 9
ENSDART00000113559 Nonsense 570 1573 6 8
Genomic Location (Zv9):
Chromosome 1 (position 47902670)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46714331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGAAGAAAMCAGAACAGGGGCCTCTTCAAGCCATGATGGCCCAGTCA[C/T]AAAGTCTTGGGAAGCCAGGTGGTCCAGGAGGACCAYGTCCRGATGGTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link