ccnt2a

Ensembl ID:
ENSDARG00000036685
ZFIN ID:
ZDB-GENE-030131-5779
Description:
cyclin-T2 isoform 2 [Source:RefSeq peptide;Acc:NP_956122]
Human Orthologue:
CCNT2
Human Description:
cyclin T2 [Source:HGNC Symbol;Acc:1600]
Mouse Orthologue:
Ccnt2
Mouse Description:
cyclin T2 Gene [Source:MGI Symbol;Acc:MGI:1920199]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2506 Nonsense F2 line generated During 2014
sa12646 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2506
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053282 Nonsense 346 630 9 10
Genomic Location:
Chromosome 9 (position 24269917)
KASP Assay ID:
554-3040.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGGAACCTCATATACTTACACTGCTCCCAGTGACTGGCCTCAGGAC[C/T]AACTGCGCTCAGACCCGTATTCTGTCAAACAGCTTCCCTCRCACAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12646
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053282 Nonsense 439 630 9 10
Genomic Location:
Chromosome 9 (position 24269638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAARCAAGAGCAGCAGAACGTGGAGACTGAGGTCTACGGTGCTACAACA[C/T]AGACAGATCACCGCAAGCACCTGCCCCACCTGTCTCATGGGCAGCAGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1qvkiysf