hnrnpa1

Ensembl ID:
ENSDARG00000036675
ZFIN ID:
ZDB-GENE-030912-14
Description:
heterogeneous nuclear ribonucleoprotein A1 [Source:RefSeq peptide;Acc:NP_956398]
Human Orthologue:
HNRNPA2B1
Human Description:
heterogeneous nuclear ribonucleoprotein A2/B1 [Source:HGNC Symbol;Acc:5033]
Mouse Orthologue:
Hnrnpa2b1
Mouse Description:
heterogeneous nuclear ribonucleoprotein A2/B1 Gene [Source:MGI Symbol;Acc:MGI:104819]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39423 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053267 Essential Splice Site 233 403 7 11
ENSDART00000127174 Essential Splice Site 111 281 4 9
ENSDART00000131711   None 65 None 2
ENSDART00000134607   None 120 None 4
Genomic Location (Zv9):
Chromosome 23 (position 36359773)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36209426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATTTTAATGTTATTTCTTTGTAACTTAGTAGTTTTACTGTTATTTT[A/T]GGAGGAAGAGGAAATAACTTTGGAGGTGGTGGTGGCGGCGGTGGCTATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link