tnni1al

Ensembl ID:
ENSDARG00000036671
ZFIN ID:
ZDB-GENE-040625-81
Description:
troponin I, skeletal, slow like [Source:RefSeq peptide;Acc:NP_001002101]
Human Orthologues:
TNNI1, TNNI2, TNNI3
Human Descriptions:
troponin I type 1 (skeletal, slow) [Source:HGNC Symbol;Acc:11945]
troponin I type 2 (skeletal, fast) [Source:HGNC Symbol;Acc:11946]
troponin I type 3 (cardiac) [Source:HGNC Symbol;Acc:11947]
Mouse Orthologues:
Tnni1, Tnni2, Tnni3
Mouse Descriptions:
troponin I, cardiac 3 Gene [Source:MGI Symbol;Acc:MGI:98783]
troponin I, skeletal, fast 2 Gene [Source:MGI Symbol;Acc:MGI:105070]
troponin I, skeletal, slow 1 Gene [Source:MGI Symbol;Acc:MGI:105073]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11408 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053265 Essential Splice Site 94 180 5 8
ENSDART00000143441 Essential Splice Site 94 180 6 9
Genomic Location:
Chromosome 25 (position 20586074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGAGAGGTACGACATCGCAGCCAAGGTGTCCAAAAATGAAAAAGAG[G/A]TACAGTATACCGCAYCCTAAATGGAGTCAACTTGCTTCACAWTACACTTNNT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0hi5vkxg