cdadc1

Ensembl ID:
ENSDARG00000036650
ZFIN ID:
ZDB-GENE-041114-163
Description:
Cytidine and dCMP deaminase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3U4]
Human Orthologue:
CDADC1
Human Description:
cytidine and dCMP deaminase domain containing 1 [Source:HGNC Symbol;Acc:20299]
Mouse Orthologue:
Cdadc1
Mouse Description:
cytidine and dCMP deaminase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919141]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32746 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053232 Nonsense 369 471 6 7

The following transcripts of ENSDARG00000036650 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47116880)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45928541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGCTTTATCTAGTGGGCTGCGGATACAACGCTTATCCAGTGGGCTCA[C/T]AGTACGCAGAGTATCCTCAGATGGACCACAAGCAGGAGGAAAGACAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link