rcbtb1

Ensembl ID:
ENSDARG00000036645
ZFIN ID:
ZDB-GENE-030131-7951
Description:
RCC1 and BTB domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_956285]
Human Orthologue:
RCBTB1
Human Description:
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 [Source:HGNC S
Mouse Orthologue:
Rcbtb1
Mouse Description:
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 Gene [Source:M

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19559 Nonsense Mutation detected in F1 DNA During 2014
sa4864 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16057 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053222 Nonsense 172 531 5 12
Genomic Location:
Chromosome 1 (position 47139993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACTGTGGTCAGGTGGGTTCAGGGTCCACTGCCAACCAGCCTACACCA[C/T]GAAAAGTCTCCAACTGTCTGCAGAACAAAGTGATTGTTAATATAGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053222 Essential Splice Site 201 531 5 12
Genomic Location:
Chromosome 1 (position 47139903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATAGCCTGTGGACAGACCTCATCAATGGCTGTGACGGATAATGGTGAG[G/A]TAAGGGATAAAATTTACCCAACTTMGAGCTCGCCATTAGTTGAAATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053222 Nonsense 237 531 6 12
Genomic Location:
Chromosome 1 (position 47139629)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGCTCACGCCATGCCGTTTGATTGCACTACAAGGCTTCTGTGTGCTG[C/T]AGGTATAYACTWAAAAGCTTTTGTGTTCCCAGATTGTTAGCTGCATGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kijc6kur