arl11

Ensembl ID:
ENSDARG00000036637
ZFIN ID:
ZDB-GENE-030131-3410
Description:
ADP-ribosylation factor-like protein 11 [Source:RefSeq peptide;Acc:NP_955987]
Human Orthologue:
ARL11
Human Description:
ADP-ribosylation factor-like 11 [Source:HGNC Symbol;Acc:24046]
Mouse Orthologue:
Arl11
Mouse Description:
ADP-ribosylation factor-like 11 Gene [Source:MGI Symbol;Acc:MGI:2444054]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053221 Nonsense 7 176 1 1
Genomic Location:
Chromosome 1 (position 47149852)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACCCWTCGTAAGCTCATCCAGGATCCAAAATGGGCGCCATCAAGTCC[A/T]AACGGTTTAAAARGCCTCCTCAGGTGCTCATCATGGGCTTGGATTCAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n2kaawxa