plp2

Ensembl ID:
ENSDARG00000036630
ZFIN ID:
ZDB-GENE-030710-11
Description:
proteolipid protein 2 [Source:RefSeq peptide;Acc:NP_001154917]
Human Orthologue:
PLP2
Human Description:
proteolipid protein 2 (colonic epithelium-enriched) [Source:HGNC Symbol;Acc:9087]
Mouse Orthologues:
Gm6169, Plp2
Mouse Descriptions:
predicted gene 6169 Pseudogene [Source:MGI Symbol;Acc:MGI:3646298]
proteolipid protein 2 Gene [Source:MGI Symbol;Acc:MGI:1298382]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18195 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053203 Essential Splice Site 32 153 None 5
ENSDART00000127032 Essential Splice Site 32 153 None 5
Genomic Location (Zv9):
Chromosome 8 (position 51605915)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49356302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGARCTATGCGCGGACTCGAAAGGGGACGAWACTGGCCGCCGAAATAG[T/C]AAGTTTTCAACACGTCGGTGTATTTTATTTAGCCTTTATTTCATTTTGTR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link