rps14

Ensembl ID:
ENSDARG00000036629
ZFIN ID:
ZDB-GENE-030131-8631
Description:
40S ribosomal protein S14 [Source:RefSeq peptide;Acc:NP_956320]
Human Orthologue:
RPS14
Human Description:
ribosomal protein S14 [Source:HGNC Symbol;Acc:10387]
Mouse Orthologues:
Gm5805, Rps14
Mouse Descriptions:
predicted gene 5805 Gene [Source:MGI Symbol;Acc:MGI:3644633]
ribosomal protein S14 Gene [Source:MGI Symbol;Acc:MGI:98107]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17420 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053208 Nonsense 76 151 3 5
Genomic Location:
Chromosome 21 (position 32382831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAAGGTGAAGGCCGACAGAGATGAGTCTTCTCCTTATGCTGCTATGT[T/A]GGCAGCTCAGGATGTGGCTCAAAAGTGCAAAGAGCTGGGCATCACTGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n8twr49e