cd74

Ensembl ID:
ENSDARG00000036628
ZFIN ID:
ZDB-GENE-990910-10
Description:
CD74 molecule, major histocompatibility complex, class II invariant chain [Source:RefSeq peptide;Ac
Human Orthologue:
CD74
Human Description:
CD74 molecule, major histocompatibility complex, class II invariant chain [Source:HGNC Symbol;Acc:16
Mouse Orthologue:
Cd74
Mouse Description:
CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14165 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053205 Nonsense 14 198 1 6
Genomic Location (Zv9):
Chromosome 21 (position 32381165)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33424147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGATCAAAAATGTCTAGCGAGGGAAACGAGACACCACTAATAAGTGAC[C/T]AATCTTCAGTTAACATGGGACCTCAGCCAAGGTGAGAAAGTTATTTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link