si:ch211-168n16.1

Ensembl ID:
ENSDARG00000036626
ZFIN ID:
ZDB-GENE-040724-23
Description:
Semaphorin 6ba [Source:UniProtKB/TrEMBL;Acc:B6E514]
Human Orthologue:
SEMA6B
Human Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B [Source:HGNC Symbol;
Mouse Orthologue:
Sema6b
Mouse Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B Gene [Source:MGI Sym

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33030 Nonsense Mutation detected in F1 DNA During 2017
sa38358 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39939 Nonsense Mutation detected in F1 DNA During 2017
sa17007 Nonsense Available for shipment Available now
sa6865 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053204 Nonsense 29 872 1 16
Genomic Location (Zv9):
Chromosome 2 (position 49802662)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49498432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTGCTCCAATTGGCTGCCTGCTCGTTTCCAGAGGAACCTGAGCCTT[T/A]AATCTCCGCCCCCGCTGAGGGTAAGGACACGCCCCCTCCCCTTTTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053204 Essential Splice Site 249 872 9 16
Genomic Location (Zv9):
Chromosome 2 (position 49858393)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49554163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAAACAAACCTATCCCTAATGTTAATCTGGCCCTTTGTGTGTGTTTC[A/G]GGTGATGGTGTCTCGTGTGGCGCGTGTGTGTAAAGGAGATCTGGGCGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053204 Nonsense 297 872 9 16
Genomic Location (Zv9):
Chromosome 2 (position 49858539)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49554309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAACTGCTCCATCCCTGGAGACTCACACTTCTACTTCAACCTGCTG[C/T]AGTCCACCAGCCCCATCATACGCATGCAGGGCAGAGACGTCATCCTGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053204 Nonsense 342 872 10 16
Genomic Location (Zv9):
Chromosome 2 (position 49875651)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49571421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGGTGTGTGCGTTYGACATGCAGCAGCTGGCACGTGTGTTTGAGGGC[A/T]GATTCAAAGAGCAGAAATCACCAGAATCCATATGGACACCAGTACCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053204 Nonsense 640 872 16 16
Genomic Location (Zv9):
Chromosome 2 (position 49911803)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49607573
KASP Assay ID:
554-5246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCGTCMAGTATTCAGCGGAAGAGYGAGAARGAACGTTGCATGATGGGA[C/T]AAAGCAGAAGCGGCTCTGTAATGAGCGTATCCCGACACAGTGGCACAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link