MGAT3 (1 of 2)

Ensembl ID:: ENSDARG00000036619
Description:: mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7
Human Orthologue:: MGAT3
Human Description:: mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7
Mouse Orthologue:: Mgat3
Mouse Description:: mannoside acetylglucosaminyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:104532]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa25324	Essential Splice Site	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa25324
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000053184	Essential Splice Site	138	500	4	5

Genomic Location:: Chromosome 6 (position 152500)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: GCTTCCGGCAGGGCACAGAAGTGGCGCCACCCAAAGACGAAACGCTAAAA[G/A]TGAAACCCAGCGCCGCAGGAGTGATCCAGCGGAGAATACTGCAGAAACCC
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for MGAT3

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: