MGAT3 (1 of 2)

Ensembl ID:
ENSDARG00000036619
Description:
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7
Human Orthologue:
MGAT3
Human Description:
mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7
Mouse Orthologue:
Mgat3
Mouse Description:
mannoside acetylglucosaminyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:104532]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25324 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053184 Essential Splice Site 138 500 4 5
Genomic Location:
Chromosome 6 (position 152500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCCGGCAGGGCACAGAAGTGGCGCCACCCAAAGACGAAACGCTAAAA[G/A]TGAAACCCAGCGCCGCAGGAGTGATCCAGCGGAGAATACTGCAGAAACCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8z8gnt06