gpr182

Ensembl ID:
ENSDARG00000036616
ZFIN ID:
ZDB-GENE-030131-2361
Description:
G-protein coupled receptor 182 [Source:RefSeq peptide;Acc:NP_001018314]
Human Orthologue:
GPR182
Human Description:
G protein-coupled receptor 182 [Source:HGNC Symbol;Acc:13708]
Mouse Orthologue:
Gpr182
Mouse Description:
G protein-coupled receptor 182 Gene [Source:MGI Symbol;Acc:MGI:109545]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1354 Nonsense Confirmed mutation in F2 line During 2014
sa12195 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1354
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053189 Nonsense 64 358 2 2
Genomic Location:
Chromosome 23 (position 36700526)
KASP Assay ID:
554-1268.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGCAGAGAACACCATTGTAGTGTGGGTAAACTGGAAAAGACGGCATT[C/A]AGCGAATGGGGTGCTGTTCTGCATCATCAACGTGAGCTTGTCTGATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053189 Nonsense 223 358 2 2
Genomic Location:
Chromosome 23 (position 36701002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTCTGGCTCCAGCGTCTGTCATTATAACCTGCAACTTCTTGATMGCC[A/T]GAGCCGTCCGCACTGCTCCWGAGGTCCAGAATCGTCGGGATGTCTGGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pvsuxko1