gpr182

Ensembl ID:
ENSDARG00000036616
ZFIN ID:
ZDB-GENE-030131-2361
Description:
G-protein coupled receptor 182 [Source:RefSeq peptide;Acc:NP_001018314]
Human Orthologue:
GPR182
Human Description:
G protein-coupled receptor 182 [Source:HGNC Symbol;Acc:13708]
Mouse Orthologue:
Gpr182
Mouse Description:
G protein-coupled receptor 182 Gene [Source:MGI Symbol;Acc:MGI:109545]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1354 Nonsense Confirmed mutation in F2 line During 2016
sa37767 Nonsense Mutation detected in F1 DNA During 2016
sa12195 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1354
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053189 Nonsense 64 358 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36700526)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36532003
KASP Assay ID:
554-1268.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGCAGAGAACACCATTGTAGTGTGGGTAAACTGGAAAAGACGGCATT[C/A]AGCGAATGGGGTGCTGTTCTGCATCATCAACGTGAGCTTGTCTGATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053189 Nonsense 194 358 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36700917)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36532394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGATGAACCGGGTTGCTACATGGTTCCTGAGCAGTACCACACAGAATG[G/A]TTTCTGTCCGTTTCCTTCCTATGCCTGATTTTCCAGTTTCTGGCTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053189 Nonsense 223 358 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36701002)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36532479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTCTGGCTCCAGCGTCTGTCATTATAACCTGCAACTTCTTGATMGCC[A/T]GAGCCGTCCGCACTGCTCCWGAGGTCCAGAATCGTCGGGATGTCTGGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link