FAM193A

Ensembl ID:
ENSDARG00000036595
Description:
family with sequence similarity 193, member A [Source:HGNC Symbol;Acc:16822]
Human Orthologue:
FAM193A
Human Description:
family with sequence similarity 193, member A [Source:HGNC Symbol;Acc:16822]
Mouse Orthologue:
Fam193a
Mouse Description:
family with sequence similarity 193, member A Gene [Source:MGI Symbol;Acc:MGI:2447768]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7383 Missense Mutation detected in F1 DNA During 2014
sa9068 Nonsense Mutation detected in F1 DNA During 2014
sa18701 Nonsense Mutation detected in F1 DNA During 2014
sa4856 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14253 Essential Splice Site Available for shipment Available now
sa14151 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Missense 254 1476 5 23
Genomic Location:
Chromosome 1 (position 37177402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGACTGGGACTCCACTGGCTGACGATCAGGATCAGCCTCTCGATCGG[G/C]ACAAAGAGAGCATGAAGGAACTTGTTGACAGGTACTCTTGAATGACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Nonsense 280 1476 6 23
ENSDART00000075216 Nonsense 280 1476 6 23
Genomic Location:
Chromosome 1 (position 37180682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGCTTTGTGAGAAGGATCCCTACCAGTTGTACCAGCGTCTAGARCAG[C/T]AGGCAAGAGAGTACGTCTTAGAGATGAAGGTGCGGCTGCTCAAACACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Nonsense 280 1476 6 23
ENSDART00000075216 Nonsense 280 1476 6 23
Genomic Location:
Chromosome 1 (position 37180682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGCTTTGTGAGAAGGATCCCTACCAGTTGTACCAGCGTCTAGAACAG[C/T]AGGCAAGAGAGTACGTCTTAGAGATGAAGGTGCGGCTGCTCAAACACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Essential Splice Site 433 1476 9 23
Genomic Location:
Chromosome 1 (position 37186100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTAATGATTGGCGGCTCTTGCATCTAACGTGCAGTTTTGTCTGTTTGCA[G/T]TTGCTTTTTAAGGTTGAAGGTCAGAATCTCACAAATCAAAGGACWGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Essential Splice Site 1419 1476 21 23
ENSDART00000075216 Essential Splice Site 1419 1476 21 23
Genomic Location:
Chromosome 1 (position 37209876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAGAAGAATAAGAAGAAAAAAGGAGATAAGATGAATAACTCAATAGG[T/C]YAGTTTTGTCAAGTGCTCAAGATAAATGATAAAAAGAAGGGCTTTTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075216 Essential Splice Site 1419 1476 21 23
ENSDART00000075216 Essential Splice Site 1419 1476 21 23
Genomic Location:
Chromosome 1 (position 37209876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAGAAGAATAAGAAGAAAAAAGGAGATAAGATGAATAACTCAATAGG[T/C]YAGTTTTGTCAAGTGCTCAAGATAAATGATAAAAAGAAGGGCTTTTAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p7asvny7