setd4

Ensembl ID:
ENSDARG00000036592
ZFIN ID:
ZDB-GENE-050808-2
Description:
SET domain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001039027]
Human Orthologue:
SETD4
Human Description:
SET domain containing 4 [Source:HGNC Symbol;Acc:1258]
Mouse Orthologue:
Setd4
Mouse Description:
SET domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2136890]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12614 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053157 Nonsense 421 440 10 10
ENSDART00000144899   None 211 None 6

The following transcripts of ENSDARG00000036592 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47603789)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46415450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGAACCAGTCTGGCCTTGAACAACTGTGTGTGGTGGAGAGCCTGAGA[C/T]GAGARGAGCAAAASATTCTGGGACACACACGAGGGCTTCTCCAAAACCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link