CXorf57 (2 of 2)

Ensembl ID:
ENSDARG00000036575
Description:
chromosome X open reading frame 57 [Source:HGNC Symbol;Acc:25486]
Human Orthologue:
CXorf57
Human Description:
chromosome X open reading frame 57 [Source:HGNC Symbol;Acc:25486]
Mouse Orthologue:
D330045A20Rik
Mouse Description:
RIKEN cDNA D330045A20 gene Gene [Source:MGI Symbol;Acc:MGI:2147848]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31560 Nonsense Available for shipment Available now
sa20896 Nonsense Available for shipment Available now
sa34034 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053138 Nonsense 396 809 6 15
Genomic Location (Zv9):
Chromosome 7 (position 20571319)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19161755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCAGAGATGGAGGAGTATCGCTGGATCCAGATGGTGGACCGGACAT[C/A]AGACCAGCCAATCATGATCAAACTTTTCTCCACATCACAGCCTGATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053138 Nonsense 398 809 6 15
Genomic Location (Zv9):
Chromosome 7 (position 20571314)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19161750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGATGGAGGAGTATCGCTGGATCCAGATGGTGGACCGGACATCAGAC[C/T]AGCCAATCATGATCAAACTTTTCTCCACATCACAGCCTGATGTTCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053138 Essential Splice Site 513 809 8 15
Genomic Location (Zv9):
Chromosome 7 (position 20568227)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19158663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCACCTCTTCCTGTTTCACTGCATTATTTCATGGAGAGCAAACAAAG[T/C]AAGGAAGCACAGATATATACAAAAATATGTGTTTTTGGATTGAATGATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link