sema3e

Ensembl ID:
ENSDARG00000036571
ZFIN ID:
ZDB-GENE-030131-7864
Description:
semaphorin-3E [Source:RefSeq peptide;Acc:NP_001038549]
Human Orthologue:
SEMA3E
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E [Source:HGNC
Mouse Orthologue:
Sema3e
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E Gene [Source:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36577 Nonsense Mutation detected in F1 DNA During 2017
sa43052 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36578 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053125 Nonsense 267 768 7 17
Genomic Location (Zv9):
Chromosome 18 (position 9007425)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9584401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTTGAGGGAGGAAATAAAGCTGTTTACACCAGAGTGGCCAGAGTCTG[T/A]GCGGTATGGAACACACATCAGAAAAACTTTAAGTAAAACTAGCTTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053125 Essential Splice Site 268 768 7 17
Genomic Location (Zv9):
Chromosome 18 (position 9007430)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9584406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGGAGGAAATAAAGCTGTTTACACCAGAGTGGCCAGAGTCTGTGCGG[T/A]ATGGAACACACATCAGAAAAACTTTAAGTAAAACTAGCTTTGTTCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053125 Nonsense 499 768 14 17
Genomic Location (Zv9):
Chromosome 18 (position 9019899)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9596875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACAGTGGTCCTCATCTGAAAGCGGTGTGTTTGTGTATTTATAGCAA[C/T]AGCTGTATGTGGGCTCGGAGTTGGGTGTAACACAGATCCGTGTGCATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link