LOC557210

Ensembl ID:
ENSDARG00000036569
Human Orthologue:
BACH2
Human Description:
BTB and CNC homology 1, basic leucine zipper transcription factor 2 [Source:HGNC Symbol;Acc:14078]
Mouse Orthologue:
Bach2
Mouse Description:
BTB and CNC homology 2 Gene [Source:MGI Symbol;Acc:MGI:894679]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42898 Nonsense Mutation detected in F1 DNA During 2016
sa23029 Nonsense Mutation detected in F1 DNA During 2016
sa11743 Nonsense Available for shipment Available now
sa28828 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Nonsense 368 727 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15563501)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15714329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCTCAAATCGCTTTCTCTTGAGAGGATTTGTTCACAAGATCCCGAA[C/T]AAGAGAACGACAGAAAAAGTGTCATCTTTTCCTCTCGAGGCCCCTACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Nonsense 390 727 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15563568)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15714396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGTCATCTTTTCCTCTCGAGGCCCCTACCATTTGGCGCCCACACATT[C/A]ATATCCTGATGAGAGTTGTTTGGGGCAGGAGACTCCAGAAGACCTGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Nonsense 432 727 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15563695)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15714523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCCCAAACTCTGTCCCCAACTTCGTCCTCTCAAGATCCCTCTTTGCCCTA[T/A]CGCCGGCACCCTAAGAGCAGTTGTCCGGTGYCCAWTAAAATGTGTTCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019017 Essential Splice Site 467 727 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15563800)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15714628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCGTGCCGATAGCCATGTCAGAACCTCCAGCTCATGCTCTTCCTACTC[G/T]TATGCAGAGGACGGCAGTGGAGGCTCTCCTTCCAGCCTGCCCCAGTTCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link