col18a1

Ensembl ID:
ENSDARG00000036558
ZFIN ID:
ZDB-GENE-030516-3
Description:
Collagen type XVIII alpha 1 [Source:UniProtKB/TrEMBL;Acc:B0S8G3]
Human Orthologue:
COL18A1
Human Description:
collagen, type XVIII, alpha 1 [Source:HGNC Symbol;Acc:2195]
Mouse Orthologue:
Col18a1
Mouse Description:
collagen, type XVIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3739 Nonsense Mutation detected in F1 DNA During 2014
sa18963 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007058 Nonsense 25 1383 1 41
ENSDART00000053118 Nonsense 25 1385 1 42
ENSDART00000097295 None None 1349 None 42
ENSDART00000130434 Nonsense 25 1645 1 41
Genomic Location:
Chromosome 9 (position 42987575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTGCCTCTTTATTTTGGCATGCGTGAGGATACGCCACACACATGGCT[G/A]GTTCTGGTTTGATGAYTCCAAGGAARTTGAGAAGGGYGTGCAGACACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007058 Nonsense 797 1383 25 41
ENSDART00000053118 Nonsense 798 1385 25 42
ENSDART00000097295 Nonsense 763 1349 26 42
ENSDART00000130434 Nonsense 1059 1645 25 41
Genomic Location:
Chromosome 9 (position 43041705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAACAAACTTGTTTACAGGGGGAGAAAGGAGAACCTGGACTTATTCTT[G/T]GACCTGATGGAAATCCACTTTACCTTGGTGGATTGACAGGACAGAAGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lyhb4zxy