col18a1

Ensembl ID:
ENSDARG00000036558
ZFIN ID:
ZDB-GENE-030516-3
Description:
Collagen type XVIII alpha 1 [Source:UniProtKB/TrEMBL;Acc:B0S8G3]
Human Orthologue:
COL18A1
Human Description:
collagen, type XVIII, alpha 1 [Source:HGNC Symbol;Acc:2195]
Mouse Orthologue:
Col18a1
Mouse Description:
collagen, type XVIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88451]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34722 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007058 Essential Splice Site 842 1383 27 41
ENSDART00000053118 Essential Splice Site 843 1385 27 42
ENSDART00000097295 Essential Splice Site 808 1349 28 42
ENSDART00000130434 Essential Splice Site 1104 1645 27 41
Genomic Location (Zv9):
Chromosome 9 (position 43042116)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42167286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGACCTCCTGGTGCAAAAGGTGAATTCGGAATGCCAGGCAGACCTG[T/A]AAGTCTTTCACAAAACAACTTTCATTAACCTACAACTATTGTATGGCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link