agpat3

Ensembl ID:
ENSDARG00000036549
ZFIN ID:
ZDB-GENE-040426-2765
Description:
1-acyl-sn-glycerol-3-phosphate acyltransferase gamma [Source:RefSeq peptide;Acc:NP_998590]
Human Orthologue:
AGPAT3
Human Description:
1-acylglycerol-3-phosphate O-acyltransferase 3 [Source:HGNC Symbol;Acc:326]
Mouse Orthologue:
Agpat3
Mouse Description:
1-acylglycerol-3-phosphate O-acyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1336186]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9087 Nonsense Mutation detected in F1 DNA During 2016
sa19560 Nonsense Available for shipment Available now
sa39676 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32749 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Nonsense 68 377 4 10
ENSDART00000135795 Nonsense 68 116 4 4
ENSDART00000145167 Nonsense 68 221 4 6
Genomic Location (Zv9):
Chromosome 1 (position 47351328)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46162989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWCTCTCTTTTATCTTTATATTAGAGTTAGTGATGTTGTTGGAGTGGTG[G/A]TCTGGCACTGAGTGCACGCTGTAYACCGATCAGGCMACGGTGGATAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Nonsense 109 377 4 10
ENSDART00000135795 Nonsense 109 116 4 4
ENSDART00000145167 Nonsense 109 221 4 6
Genomic Location (Zv9):
Chromosome 1 (position 47351205)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46162866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCAACCACAACTTCGAGGTGGACTTTCTGTGTGGCTGGACCATCTG[T/A]GAGAGATACGGCGTGCTGGGGGTGAGTCCCGATGAGCAGTGAAGAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Essential Splice Site 222 377 None 10
ENSDART00000135795   None 116 None 4
ENSDART00000145167   222 221 None 6
Genomic Location (Zv9):
Chromosome 1 (position 47345649)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46157310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGCACCAAAGGATTCACCACCACACTGCAATGCCTAAAGGGAACAGG[T/G]CAGACAAACACTTGTGCACACACCCCGTCATTGTCACACACAGTTTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Nonsense 253 377 7 10
ENSDART00000135795   None 116 None 4
ENSDART00000145167   None 221 None 6
Genomic Location (Zv9):
Chromosome 1 (position 47340303)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46151964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCCGACTCTGTTGGGGATTGTCAATGGGAAGAAGTACAAAGCAGACT[T/A]GAGTGTCAGGTGAGTCTCCCAGTTCACTGATATCACTGTATATAATAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link