agpat3

Ensembl ID:
ENSDARG00000036549
ZFIN ID:
ZDB-GENE-040426-2765
Description:
1-acyl-sn-glycerol-3-phosphate acyltransferase gamma [Source:RefSeq peptide;Acc:NP_998590]
Human Orthologue:
AGPAT3
Human Description:
1-acylglycerol-3-phosphate O-acyltransferase 3 [Source:HGNC Symbol;Acc:326]
Mouse Orthologue:
Agpat3
Mouse Description:
1-acylglycerol-3-phosphate O-acyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1336186]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9087 Nonsense Mutation detected in F1 DNA During 2014
sa19560 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Nonsense 68 377 4 10
ENSDART00000135795 Nonsense 68 116 4 4
ENSDART00000145167 Nonsense 68 221 4 6
Genomic Location:
Chromosome 1 (position 47351328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWCTCTCTTTTATCTTTATATTAGAGTTAGTGATGTTGTTGGAGTGGTG[G/A]TCTGGCACTGAGTGCACGCTGTAYACCGATCAGGCMACGGTGGATAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115081 Nonsense 109 377 4 10
ENSDART00000135795 Nonsense 109 116 4 4
ENSDART00000145167 Nonsense 109 221 4 6
Genomic Location:
Chromosome 1 (position 47351205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCAACCACAACTTCGAGGTGGACTTTCTGTGTGGCTGGACCATCTG[T/A]GAGAGATACGGCGTGCTGGGGGTGAGTCCCGATGAGCAGTGAAGAGATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r8bexsvx