pknox1.2

Ensembl ID:
ENSDARG00000036542
ZFIN ID:
ZDB-GENE-020123-1
Description:
Pbx/knotted 1 homeobox 1.2 [Source:UniProtKB/TrEMBL;Acc:B8A551]
Human Orthologue:
PKNOX1
Human Description:
PBX/knotted 1 homeobox 1 [Source:HGNC Symbol;Acc:9022]
Mouse Orthologue:
Pknox1
Mouse Description:
Pbx/knotted 1 homeobox Gene [Source:MGI Symbol;Acc:MGI:1201409]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9775 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053097 Essential Splice Site 71 335 2 8
ENSDART00000125032 Essential Splice Site 128 402 4 10
ENSDART00000130607 Essential Splice Site 128 445 3 10
Genomic Location (Zv9):
Chromosome 1 (position 47472722)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46284383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGAAGGCAAGGCTTTCTTCAGCGAGGACCCTGATTTGGACAATCTGG[T/A]ATGAAGCACCTTGTTGCATCTAAAATGACATTKAAGTTTCATCACCATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link