ccnt2b

Ensembl ID:
ENSDARG00000036510
ZFIN ID:
ZDB-GENE-030131-183
Description:
cyclin T2b [Source:RefSeq peptide;Acc:NP_997751]
Human Orthologue:
CCNT2
Human Description:
cyclin T2 [Source:HGNC Symbol;Acc:1600]
Mouse Orthologue:
Ccnt2
Mouse Description:
cyclin T2 Gene [Source:MGI Symbol;Acc:MGI:1920199]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13916 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053045 Nonsense 360 569 9 9
ENSDART00000143599 None None 180 None 6
Genomic Location:
Chromosome 22 (position 12284870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGGCTCCGAMAAGCAAACATGGACATAGCTCTGCCACTCTGGCTCCT[C/T]AGAAACTCACTCTAGAGAARTACCGTGAAAAACAAAYCGAATTAGAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5lg2uut1