ccnt2b

Ensembl ID:
ENSDARG00000036510
ZFIN ID:
ZDB-GENE-030131-183
Description:
cyclin T2b [Source:RefSeq peptide;Acc:NP_997751]
Human Orthologue:
CCNT2
Human Description:
cyclin T2 [Source:HGNC Symbol;Acc:1600]
Mouse Orthologue:
Ccnt2
Mouse Description:
cyclin T2 Gene [Source:MGI Symbol;Acc:MGI:1920199]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13916 Nonsense Available for shipment Available now
sa32387 Nonsense Mutation detected in F1 DNA During 2016
sa32388 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053045 Nonsense 360 569 9 9
ENSDART00000143599   None 180 None 6
Genomic Location (Zv9):
Chromosome 22 (position 12284870)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12145038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGGCTCCGAMAAGCAAACATGGACATAGCTCTGCCACTCTGGCTCCT[C/T]AGAAACTCACTCTAGAGAARTACCGTGAAAAACAAAYCGAATTAGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053045 Nonsense 423 569 9 9
ENSDART00000143599   None 180 None 6
Genomic Location (Zv9):
Chromosome 22 (position 12285059)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12145227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATCAACAGCAGGTACTGGAGCGACCGTCGAAGAGCGGGTCACTCAAA[C/T]GACGCCACCCTTCCTCATCAGAGAATGGTTCCGCTAGTCAAGAAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053045 Nonsense 463 569 9 9
ENSDART00000143599   None 180 None 6
Genomic Location (Zv9):
Chromosome 22 (position 12285179)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12145347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTGACAGTAGCGGCAGTAGTAAGAGCCGTCACAGTCCACTCTCCAGC[C/T]GAGAGAAGCATCGTGAACATTCATCCCACAAAACAGCGAGACACGATTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link