fam122b

Ensembl ID:
ENSDARG00000036500
ZFIN ID:
ZDB-GENE-040801-204
Description:
hypothetical protein LOC445072 [Source:RefSeq peptide;Acc:NP_001003466]
Human Orthologues:
FAM122A, FAM122B
Human Descriptions:
family with sequence similarity 122A [Source:HGNC Symbol;Acc:23490]
family with sequence similarity 122B [Source:HGNC Symbol;Acc:30490]
Mouse Orthologues:
Fam122a, Fam122b
Mouse Descriptions:
family with sequence similarity 122, member A Gene [Source:MGI Symbol;Acc:MGI:1915284]
family with sequence similarity 122, member B Gene [Source:MGI Symbol;Acc:MGI:1926005]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22506 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa15466 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053026 Splice Site, Nonsense 100 278 4 10

The following transcripts of ENSDARG00000036500 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 32408368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGTAGGAAGAAGGTGTTGATGTGATGAACCGTGAAACTGCTCATGAA[C/T]GGTAAGAGCTCGCATCTGCTGAAGCCCCAGGGCATTGCTTTCTCATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053026 Essential Splice Site 152 278 6 10

The following transcripts of ENSDARG00000036500 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 32410657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGCCTGTGTCTCCTGCTCCTTCACCCACTAGAGGGATTGGAAAGAAG[G/A]TATCGCTTTMTTTTCCTTAATAAATGTTTTATTWTTGTTWTGCARGCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xh0f32e1