gstcd

Ensembl ID:
ENSDARG00000036494
ZFIN ID:
ZDB-GENE-050320-41
Description:
glutathione S-transferase, C-terminal domain containing [Source:RefSeq peptide;Acc:NP_001019633]
Human Orthologue:
GSTCD
Human Description:
glutathione S-transferase, C-terminal domain containing [Source:HGNC Symbol;Acc:25806]
Mouse Orthologue:
Gstcd
Mouse Description:
glutathione S-transferase, C-terminal domain containing Gene [Source:MGI Symbol;Acc:MGI:1914803]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24856 Nonsense Mutation detected in F1 DNA During 2017
sa4866 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa24856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006394 Nonsense 304 614 3 11
ENSDART00000053016 Nonsense 300 610 5 13
ENSDART00000124185   None 342 None 4
ENSDART00000133255   None 320 None 3
ENSDART00000134661 Nonsense 304 614 4 12
Genomic Location (Zv9):
Chromosome 1 (position 50475415)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49324506
KASP Assay ID:
554-7836.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCACGCTATCCCATCTGCCCTTACTGCTGAGATGGTACCAGCGCACA[C/T]AGGAGCTCTCCGGTGTACTGAGAGCCGCAAAGGACTGTGGGATGGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4866
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006394 Nonsense 439 614 6 11
ENSDART00000053016 Nonsense 435 610 8 13
ENSDART00000124185   None 342 None 4
ENSDART00000133255   None 320 None 3
ENSDART00000134661 Nonsense 439 614 7 12
Genomic Location (Zv9):
Chromosome 1 (position 50540500)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49389591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATTTTTTTCCCTCTGTTTGTTTTCTCAGGGGCACGTTGGGATTGTTT[T/A]GGCCTACATGCTTCCTAAATGTCAGGTAAGGCTTTCTGATTTGTTCAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link