LOC566292

Ensembl ID:
ENSDARG00000036473
Human Orthologue:
SNAPC2
Human Description:
small nuclear RNA activating complex, polypeptide 2, 45kDa [Source:HGNC Symbol;Acc:11135]
Mouse Orthologue:
Snapc2
Mouse Description:
small nuclear RNA activating complex, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:1914861]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20940 Nonsense Mutation detected in F1 DNA During 2014
sa17021 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079364 Nonsense 152 413 3 4
Genomic Location:
Chromosome 7 (position 27244846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCGAGCCCTGTAGCCTGATGCACTCTGAACCTCCACACCCCGTTACA[C/T]AAACACCTGTTTTCTCCCGTCTTTACCCTGCTCACACCCCTAACACCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079364 Nonsense 306 413 4 4
Genomic Location:
Chromosome 7 (position 27242819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATGAACTGCTCATWTTGATATACCTGTTTAATTCTGTCTTCAGAGTG[T/A]GCAGTGCTGCTGGATCTGCTGATGTGTTTGCCTGAGGAGCTCCYGTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6g0bsh91