LOC566292

Ensembl ID:
ENSDARG00000036473
Human Orthologue:
SNAPC2
Human Description:
small nuclear RNA activating complex, polypeptide 2, 45kDa [Source:HGNC Symbol;Acc:11135]
Mouse Orthologue:
Snapc2
Mouse Description:
small nuclear RNA activating complex, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:1914861]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34067 Nonsense Mutation detected in F1 DNA During 2016
sa20940 Nonsense Mutation detected in F1 DNA During 2016
sa17021 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079364 Nonsense 32 413 1 4
Genomic Location:
Chromosome 7 (position 27248237)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAACCCCTGAGCAAGAACAGATAGATAGTGCCAGATCACTCTGCAAA[G/T]GATGGAATCGCAAAGACCTCCACAGCTTCTTGCAGGCTTTAAAACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079364 Nonsense 152 413 3 4
Genomic Location:
Chromosome 7 (position 27244846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCGAGCCCTGTAGCCTGATGCACTCTGAACCTCCACACCCCGTTACA[C/T]AAACACCTGTTTTCTCCCGTCTTTACCCTGCTCACACCCCTAACACCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079364 Nonsense 306 413 4 4
Genomic Location:
Chromosome 7 (position 27242819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATGAACTGCTCATWTTGATATACCTGTTTAATTCTGTCTTCAGAGTG[T/A]GCAGTGCTGCTGGATCTGCTGATGTGTTTGCCTGAGGAGCTCCYGTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link