LOC558443

Ensembl ID:
ENSDARG00000036460
Human Orthologue:
OPN3
Human Description:
opsin 3 [Source:HGNC Symbol;Acc:14007]
Mouse Orthologue:
Opn3
Mouse Description:
opsin 3 Gene [Source:MGI Symbol;Acc:MGI:1338022]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9212 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3902 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075676 Essential Splice Site 119 320 1 4
Genomic Location:
Chromosome 14 (position 32636406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGACATCACGGCTGCAAATGGTACGGTTTCGCCAATTCGCTTTTTGG[T/G]AAGTTTTGCTGAAGTTCATTCAACAGRGNACTTYCGTTTRCGAGCCYTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075676 Nonsense 159 320 2 4
Genomic Location:
Chromosome 14 (position 32640559)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGATGTGTCTGACTTCCGCAGGGCCTGGCTCTGTGTGGCTGGTTCCTG[G/A]CTATATTCACTGCTATGGACTCTTCCACCATTTCTGGGMTGGAGCAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vkh6slzd