atp11c

Ensembl ID:
ENSDARG00000036442
ZFIN ID:
ZDB-GENE-030616-51
Human Orthologue:
ATP11C
Human Description:
ATPase, class VI, type 11C [Source:HGNC Symbol;Acc:13554]
Mouse Orthologue:
Atp11c
Mouse Description:
ATPase, class VI, type 11C Gene [Source:MGI Symbol;Acc:MGI:1859661]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22510 Nonsense Mutation detected in F1 DNA During 2014
sa18437 Nonsense Available for shipment Available now
sa14500 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052938 Nonsense 93 1139 4 29
Genomic Location:
Chromosome 14 (position 33423870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCTGCAGGTGATTGTTGATACCCCAACCAGCCCTGTTACCAGTGGTT[T/A]ACCTCTGTTTTTTGTCATCACGGTGACGGCCATCAAACAGGTTAGTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052938 Nonsense 887 1139 22 29
Genomic Location:
Chromosome 14 (position 33394026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGRCATCTCTACTATGTGCGCATTGCCCATCTTGTCCAGTACTTCTTTTA[T/A]AAGGTTGGTCTGGTATTCARTGGAGCTCGCTTTAATTTTTAAGTATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052938 Nonsense 1056 1139 28 29
Genomic Location:
Chromosome 14 (position 33388777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTGCMTTCTCTTTCCTTCTCTCCCTCTCATATTTCCCAGGCCATTTT[T/A]GAARCAGCAGCGTTTGTATTTTGTGTTCGCTAACATGCTCAGTTCYGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o5qjm3qs